ARTICLE

Comparison of 10 Different Pre-Enrichment Broths for the Regeneration of Cronobacter spp. (Enterobacter sakazakii) Infected in Powdered Infant Formula

Jung-Whan Chon1https://orcid.org/0000-0003-0758-6115, Kun-Ho Seo2https://orcid.org/0000-0001-5720-0538, Hyungsuk Oh2https://orcid.org/0000-0002-1213-9515, Dongkwan Jeong3https://orcid.org/0000-0002-6305-794X, Kwang-Young Song2,4,*https://orcid.org/0000-0002-5619-8381
Author Information & Copyright
1Department of Companion Animal Health, Inje University, Gimhae, Korea
2Center for One Health and College of Veterinary Medicine, Konkuk University, Seoul, Korea
3Department of Food Nutrition, Kosin University, Busan, Korea
4Department of Companion Animal and Department of Animal Health, Seojeong University, Yangju, Korea
*Corresponding author : Kwang-Young Song, Department of Companion Animal and Department of Animal Health, Seojeong University, Yangju, Korea, Tel : +82-31-860-5075, Fax : +82-31-860-5074, E-mail : drkysong@gmail.com

© Copyright 2023, Korean Society of Dairy Science and Biotechnology. This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

Received: Aug 21, 2023; Revised: Sep 19, 2023; Accepted: Sep 20, 2023

Published Online: Sep 30, 2023

Abstract

This study aimed to assess the effectiveness of 10 different pre-enrichment methods using Real-Time polymerase chain reaction (PCR) in support of the FDA method. When the initial Cronobacter spp. (Enterobacter sakazakii) inoculation was 7.2 CFU/g, the Ct values were observed in the following order: 21.37 (Enterobacteriaceae enrichment [EE] broth), 21.95 (brain heart infusion [BHI]), 22.72 (tryptic soy broth [TSB]), 23.02 (violet red bile lactose [VRBL]), 22.31 (TSB-0.1% sodium pyruvate [SP]), 23.43 (distilled water [DW]), 24.34 (phosphate buffered saline [PBS]), 24.95 (nutrient broth [NB]), 25.82 (TSB-0.6% yeast extract [YE]), and 28.27 (violet red bile glucose [VRBG]). For an inoculation of 1.82% CFU/g of Cronobacter spp. (E. sakazakii), the Ct values were recorded in this sequence: 20.34 (EE broth), 22.16 (TSB-0.6% YE), 22.37 (BHI), 22.71 (VRBL), 22.88 (TSB), 23.01 (DW), 23.19 (NB), 23.79 (TSB-0.1% SP), 24.66 (VRBG), and 24.70 (PBS). Finally, when the inoculum of Cronobacter spp. (E. sakazakii) was 0.182 CFU/g, the Ct values followed this order: 21.93 (VRBL), 23.07 (TSB-0.6% YE), 23.31 (DW), 23.47 (PBS), 23.70 (BHI), 24.14 (TSB-0.1% SP), 25.14 (TSB), 29.00 (VRBG), 31.55 (EE broth), and were undetected in the case of NB. Consequently, these results indicate that there were no significant differences among the 10 different pre-enrichment broths. Future studies should focus on exploring pre-enrichment broths that can improve the limit of detection at very low Cronobacter spp. (E. sakazakii) concentrations and enhance the selective recovery of Cronobacter spp. (E. sakazakii) under acid, antibiotic, cold, and heat damage conditions.

Keywords: Cronobacter spp. (Enterobacter sakazakii); pre-enrichment broth; Real-Time polymerase chain reaction (PCR); regeneration; Ct value

Introduction

Cronobacter spp. (Enterobacter sakazakii) are recognized as very significant from a public health point of view, because of its potential to cause serious illness in susceptible infants exposed to contaminated powdered infant formula [1,2].

In particular, in the first few months of life after giving birth, the biggest concern is infant feeding.

If the immune system of infants is underdeveloped and then powdered infant formula is used as an alternative to breastfeeding [3]. Cronobacter spp. (E. sakazakii) is generally not known to be associated with breast milk consumption [4]. Therefore, various necessary control measures were established during powdered infant formula production to eliminate the risk of Cronobacter spp. (E. sakazakii)-associated disease [5].

Currently, the genus of Cronobacter includes a total of seven species: Cronobacter condimentiidl, Cronobacterdublinensis, Cronobacter malonaticus, Cronobacter muytjensii, Cronobacter sakazakii, Cronobacter turicensis, and Cronobacter universalis [6,7]. All Cronobacter spp. (E. sakazakii) can be isolated from clinical specimens [8]. However, most infections were investigated to be caused by three strains: C. sakazakii, C. malonaticus and C. turicensis [8]. It is generally accepted that premature infants, low birth weight newborns, and infants with underlying the medical conditions are at the highest risk of exacerbating severe Cronobacter spp. (E. sakazakii) infection [2,9].

A multi-year analysis of the incidence of invasive Cronobacter spp. (E. sakazakii) infection in infants revealed that it was caused by powdered infant formula endogenously or extrinsically contaminated with Cronobacter sakazakii. In addition, various causes have also been reported [10]. In addition, the clinical symptoms of Cronobacter spp. (E. sakazakii) infection can be divided into two categories. First, it causes wounds and urinary tract infection, sepsis, vaginitis and aspiration pneumonia in adults [11]. Second, it causes necrotizing enterocolitis, sepsis, and meningitis in neonates and infants [12]. Especially, more seriously, sequelae from Cronobacter spp. (E. sakazakii) infection often include developmental delay, hydrocephalus, learning disabilities, and other neurological sequelae [2].

Therefore, not only health care standards for treatment methods and infection control procedures for Cronobacter spp. (E. sakazakii) infections must be established, but also regions (continents), seasons, climates, and genetic variations must be considered [13].

Recently, various efforts have been made to detect Cronobacter spp. (E. sakazakii) with the newly updated scientific technologies [14,15]. Generally, the process of bacterial isolation and identification requires a pre-enrichment step, so it is very important to select and use a pre-enrichment broth that is selective and specific for Cronobacter spp. (E. sakazakii).

Unfortunately, it is true that the currently used pre-enrichment broth generally has low selectivity [16]. Therefore, for this reason, a single broth has not been widely adopted for both Gram-positive and Gram-negative bacteria in various foods including powdered infant formula [16].

Therefore, the purpose of this study is to determine the best pre-enrichment broth to increase the number of Cronobacter spp. (E. sakazakii) so that it can be detected by restoring Cronobacter spp. (E. sakazakii) even if it is in various adverse conditions.

After culture by adding 10 different pre-enrichment broths, which are widely used in powdered infant formula artificially inoculated with Cronobacter spp. (E. sakazakii) at various concentrations, at a ratio of 1:9, the Ct value was obtained by Real-Time polymerase chain reaction (PCR). The ability of 10 different pre-enrichment broths was evaluated by comparing each Ct value with each other.

Materials and Methods

1. Cronobacter spp. (Enterobacter sakazakii) and non-Cronobacter spp. (SalmonellaEnteritidis)

Cronobacter spp. (E. sakazakii) and Salmonella Enteritids (non-Cronobacter spp.) were provided by Center for Food Safety and Applied Nutrition, Food and Drug Administration, USA. The bacteria tested in this study were incubated in tryptic soy broth (TSB; Becton Dickinson, USA) at about 37°C for over 18 hr.

2. Artificial inoculation of the dried infant formula with three different cell concentrations

For obtaining 3 different cell concentrations, 10-fold serial dilutions were progressed in phosphate-buffered saline (pH 7.2). Viable cell concentrations of Cronobacter spp. (E. sakazakii) were determined by direct plating to DFI (Chromogenic Cronobacter spp. [E. sakazakii] agar, CM1055, Oxoid, USA) following incubation at 37°C for 24 hr. The powdered infant formula were bought from a retail/wholesale stores in College Park, MD, USA. Twenty-five gram (25 g) of the powdered infant formula was artificially inoculated at 3 different target levels such as high (7.2 CFU/g), medium (1.82 CFU/g) and low (0.82 CFU/g), respectively. Then, the inoculated test part was added to each of 10 different pre-enrichment cultures, and the Ct values were compared using Real-Time PCR (Fig. 1).

jmsb-41-3-103-g1
Fig. 1. The flow scheme for comparison of Ct value on 10 different pre-enrichment broth for detecting Cronobacter spp. (E. sakazakii) in powdered infant formula using by Real-Time PCR. PCR, polymerase chain reaction.
Download Original Figure
3. Comparison of Ct values by Real-Time polymerase chain reaction (PCR) after DNA template preparation

The Real-Time PCR for detecting Cronobacter spp. (E. sakazakii) was first introduced by Seo and Brackett [17]. The detection target using Real-Time PCR was the dnaG gene in the macromolecular synthesis (MMS) operon of Cronobacter spp. (E. sakazakii; Table 1).

Table 1. MMS probe and primers for detecting Cronobacter spp. (Enterobacter sakazakii) using Real-Time PCR in this study
Type Location within the MMS gene Temperature of denaturation (°C) Sequence (5’ to 3’) Reference
Probe MMS 225-258 70 6-carboxyfluorescein (the reporter dye) – agagtagtagttgtagaggccgtgcttccgaaag-6-carboxytetramethylrhodamine (the quencher dye) [17]
Primer Forward 201-222 60 gggatattgtcccctgaaacag
Backward 278-260 59 cgagaataagccgcgcatt

Final concentration of MMS probe was 250 nM, and forward & backward was 900 nM, respectively.

MMS, macromolecular synthesis; PCR, polymerase chain reaction.

Download Excel Table

Two sets of each sample (1 mL) from 10 different pre-enrichment broths were centrifuged at 14,000×g for about 10 min (Fig. 1). In order to secure the validity of this study, true positive (Cronobacter spp. [E. sakazakii] with over 108 CFU/mL), true negative (Salmonella Enteritidis with over 108 CFU/mL), and control (deionized water) were also investigated. The cell’s pellets were resuspended in PreMan Ultra (Applied Biosystems, USA) and also located at the boiling water (100°C) for about 10 min. Hence, samples were cooled during about 2 min at 15°C to 25°C and centrifuged at 14,000×g during about 10 min repeatedly. Fig. 2 showed the cycling conditions and PCR mixture composition of the ABI Prism 7000 SDS platform for the detection of Cronobacter spp. (E. sakazakii).

jmsb-41-3-103-g2
Fig. 2. Composition of PCR mixture and cycling condition of Real-Time PCR as ABI Prism 7000 SDS platform to screen the Ct value of Cronobacter spp. (Enterobacter sakazakii). PCR, polymerase chain reaction.
Download Original Figure

Consequently, the Ct values of samples extracted from 10 different pre-enrichment broths were compared with ABI Prism 7000 SDS, a Real-Time PCR machine. The availability of 10 different pre-enrichment broths was confirmed using the Ct value.

4. Statistical analysis

Ct values obtained from 10 different pre-concentration broths used in this study were analyzed for significant differences using a statistical program.

Results and Disscussion

Neonatal and infant meningitis, sepsis, and necrotizing enterocolitis are generally known to be associated with Cronobacter spp. (E. sakazakii) [1,2,617]. Therefore, accurate and rapid detection and isolation of Cronobacter spp. (E. sakazakii) from contaminated samples is very important [1,2,14,15,17]. According to the US FDA method, several steps must be taken to isolate and enumerate Cronobacter spp. (E. sakazakii) from dehydrated powdered infant formula. For example, the first is pre- enrichment, the second is subculture, the third is re-cultivation, and the fourth is yellow colony selection and striping, and so on. This process not only takes at least 6 to 7 days, but also needs to be confirmed through a Biotyping Assay such as Vitek, API 20E, and so on [2,17,18]. The pre-enrichments used here were Enterobacteriaceae enrichment (EE) broth [18]. Furthermore, According to BAM Chapter 29 (Cronobacter), revised in April 2018, the pre-concentrate used here was buffered peptone water (BPW) [18].

Hence, this study was to determine the capability of 10 different pre-enrichments using by Real-Time PCR for promoting the FDA method. First, 25 g of powdered infant formula was artificially inoculated with Cronobacter spp. (E. sakazakii), and then 225 mL of 10 different pre-enrichment broths (prewarmed to about 45°C) was added and then gently stirred until the powdered infant formula was uniformly suspended. In addition, the reconstituted preparation samples was incubated at 37°C for more than 18 hours, and DNA was extracted after collecting 1 mL from each of 10 different pre-enrichment broths. Then, after measuring the Ct value by real-time PCR analysis, the most suitable pre-enrichment broths for Cronobacter spp. (E. sakazakii) were identified. Also, the Ct value obtained using real-time PCR generally showed a low number when the cell populations of target bacteria were high [17].

First, when the inoculum of Cronobacter spp. (E. sakazakii) was 7.2 CFU/g, the Ct value appeared in the order of 21.37 (EE broth), 21.95 (brain heart infusion [BHI]), 22.72 (TSB), 23.02 (violet red bile lactose [VRBL]), 22.31 (TSB-0.1% SP), 23.43 (distilled water [DW]), 24.34 (phosphate buffered saline [PBS]), 24.95 (nutrient broth [NB]), 25.82 (TSB-0.6% YE), and 28.27 (violet red bile glucose [VRBG]; Table 2).

Table 2. Comparison of Ct values by Real-Time PCR in 10 different pre-enrichment broths after artificial inoculation of 7.2 CFU/g of Cronobacter spp. (Enterobacter sakazakii) into dried infant formula
In the inoculation volume of 7.2 CFU/g Cronobacter spp. (E. sakazakii)
Type of 10 different pre-enrichment Positive control Negative control Negative control
TSB TSB-0.6% YE DW VRBG EE TSB-0.1% SP NB VRBL BHI PBS Cronobacter spp. (E. sakazakii) Salmonella Enteritidis Deionized water
Ct value 22.72 25.82 23.43 28.27 21.37 22.31 24.95 23.02 21.92 24.34 22.49 ND ND

PCR, polymerase chain reaction; TSB, tryptic soy broth; YE, yeast extract; DW, distilled water; VRBG, violet red bile glucose; EE, Enterobacteriaceae enrichment; SP, sodium pyruvate; NB, nutrient broth; VRBL, violet red bile lactose; BHI, brain heart infusion; PBS, phosphate buffered saline; ND, not detected.

Download Excel Table

Second, when the inoculum of Cronobacter spp. (E. sakazakii) was 1.82 CFU/g, the Ct value appeared in the order of 20.34 (EE broth), 22.16 (TSB-0.6% YE), 22.37 (BHI), 22.71 (VRBL), 22.88 (TSB), 23.01 (DW), 23.19 (NB), 23.79 (TSB-0.1% SP), 24.66 (VRBG), and 24.70 (PBS; Table 3).

Table 3. Comparison of Ct values by Real-Time PCR in 10 different pre-enrichment broths after artificial inoculation of 1.82 CFU/g of Cronobacter spp. (Enterobacter sakazakii) into dried infant formula
In the inoculation volume of 1.82 CFU/g Cronobacter spp. (E. sakazakii)
Type of 10 different pre-enrichment Positive control Negative control Negative control
TSB TSB-0.6% YE DW VRBG EE TSB-0.1% SP NB VRBL BHI PBS Cronobacter spp. (E. sakazakii) Salmonella Enteritidis Deionized Water
Ct value 22.88 22.16 23.01 24.66 20.34 23.79 23.19 22.71 22.37 24.70 22.49 ND ND

PCR, polymerase chain reaction; TSB, tryptic soy broth; YE, yeast extract; DW, distilled water; VRBG, violet red bile glucose; EE, Enterobacteriaceae enrichment; SP, sodium pyruvate; NB, nutrient broth; VRBL, violet red bile lactose; BHI, brain heart infusion; PBS, phosphate buffered saline; ND, not detected.

Download Excel Table

And third, when the inoculum of Cronobacter spp. (E. sakazakii) was 0.182 CFU/g, the Ct value appeared in the order of 21.93 (VRBL), 23.07 (TSB-0.6% YE), 23.31 (DW), 23.47 (PBS), 23.70 (BHI), 24.14 (TSB-0.1% SP), 25.14 (TSB), 29.00 (VRBG), 31.55 (EE broth), and undetected (NB; Table 4).

Table 4. Comparison of Ct values by Real-Time PCR in 10 different pre-enrichment broths after artificial inoculation of 0.182 CFU/g of Cronobacter spp. (Enterobacter sakazakii) into dried infant formula
In the inoculation volume of 0.182 CFU/g Cronobacter spp. (E. sakazakii)
Type of 10 different pre-enrichment Positive control Negative control Negative control
TSB TSB-0.6% YE DW VRBG EE TSB-0.1% SP NB VRBL BHI PBS Cronobacter spp. (E. sakazakii) Salmonella Enteritidis Deionized Water
Ct value 25.14 23.07 23.31 29.00 31.55 24.14 Undet 21.93 23.70 23.47 22.49 ND ND

PCR, polymerase chain reaction; TSB, tryptic soy broth; YE, yeast extract; DW, distilled water; VRBG, violet red bile glucose; EE, Enterobacteriaceae enrichment; SP, sodium pyruvate; NB, nutrient broth; VRBL, violet red bile lactose; BHI, brain heart infusion; PBS, phosphate buffered saline; ND, not detected.

Download Excel Table

Consequently, this results exhibited there was not any significant difference between 10 different pre-enrichment broths.

In a similar study to this study, 10 enrichment broths were evaluated for their ability to aid the growth in artificial inoculations of low numbers of fastidious aerobic, microaerobic and anaerobic bacteria [19]. When 10 CFU was artificially added, most of the strains investigated performed best in cooked meat broth, fastidious anaerobic broth, and thioglycolate medium USP. Therefore, the above three enrichment broths are judged to be suitable as enrichment broth in clinical studies [19].

To date, no enrichment broth can support the growth of all microorganisms [19]. Therefore, it is important to first consider the factors affecting the choice of the enrichment broth so as to isolate pathogenic bacteria [19]. For example, the sensitivity of the broth for recovery of fastidious bacteria, the types of bacteria expected to be recovered, the types of specimens to be sampled, the easily preparation and use of the enrichment broth, the purchase price of the broth, and so on [19].

Also, when four substances (0.1 g/L sodium pyruvate, 0.5 g/L ammonium iron (III) citrate, 40 mM 8-hydroxyquinoline, and 0.1 g/L sodium deoxycholate) were added to BPW, the detection of Enterobacteriaceae in samples was improved [20]. Therefore, it is considered that it will be very helpful in detecting specific food poisoning pathogens belonging to the Enterobacteriaceae (Cronobacter spp., Salmonella spp. etc.) that require a pre-enrichment step in BPW [20]. Furthermore, it is considered that the improvement of the composition of BPW can potentially improve the recovery of Gram-negative bacteria from the sample in terms of suppression of the competing gram-positive background flora [20].

According to another study, the main difference is that universal pre-enrichment broth has a higher buffering capacity than BPW [21]. For this reason, universal pre-enrichment broth is more advantageous for samples containing damaged Salmonella [21]. Also, an important component constituting universal pre-enrichment broth is sodium pyruvate, which is known to play the significant role for restoring the damaged bacteria [21].

Six enrichment broths (BPW, Lactose broth, BHI, UPB, NB, and TSB) were investigated to select the optimal enrichment broth of damaged Salmonella from the refrigeration temperature [22]. Among them, the use of BHI was selected as the most optimal medium for enrichment of Salmonelladamaged from cold damage [22].

Universal pre-concentration broth is effective when detecting bacteria with heat damage, whereas Listeria enrichment broth is effective when the target bacteria are intact and a high background of the bacterial flora is expected [23].

Regardless of the food matrix and the number of background bacteria, no significant difference was observed in the detection of Cronobacter spp. (E. sakazakii) in mEE broth supplemented with sodium citrate compared to EE broth by conventional culture methods [24]. On the other hand, as a result of Real-Time PCR analysis, there was a statistically significant difference between mEE broth and EE broth [24].

According to a study comparing three commonly used Cronobacter spp. (E. sakazakii) enrichment broths (EE broth, Cronobacter spp. [E. sakazakii] selective broth, and modified lauryl sulfate broth) with a newly developed Enterbacter sakazakii enrichment broth, 177 strains (100%) grew in Cronobacter spp. (E. sakazakii) enrichment broth but between 2% and 6% of strains did not grow in EE broth, Cronobacter spp. (E. sakazakii) selective broth, or modified lauryl sulfate broth [25]. Nonetheless, it is not selective enough to qualify as a practically replaceable enrichment broth. Therefore, continuous development is required as an enrichment broth that is selective and effective against Cronobacter spp. (E. sakazakii) [25].

Conclusion

In conclusion, this study investigated the ability to detect Cronobacter spp. (E. sakazakii) using 10 different pre-enrichment broths. In other words, after adding 10 different pre-enrichment broths to the powered infant formula artificially inoculated at 3 different concentrations, the Ct value was analyzed by Real-Time PCR. This study did not show any statistically significant difference (p<0.05). Namely, all 10 different pre-enrichment broths tested in this study showed the same detection ability.

However, additional research must be conducted to rapidly and accurately detect Cronobacter spp. (E. sakazakii) in various samples including powdered infant formula. Furthermore, future studies of 10 different pre-enrichment broths that could improve the recovery rate of Cronobacter spp. (E. sakazakii) from acid-, antibiotic-, cold-, and heat-damage and also the limit of detection at very low Cronobacter spp. (E. sakazakii) concentrations would have to proceed.

Conflict of Interest

The authors declare no potential conflict of interest.

Acknowledgements

This work was supported by grant from Inje University, 2023.

References

1.

Pagotto FJ, Farber JM. Cronobacter spp. (Enterobacter sakazakii): advice, policy and research in Canada. Int J Food Microbiol. 2009;136:238-245.

2.

Mousavi ZE, Hunt K, Koolman L, Butler F, Fanning S. Cronobacter species in the built food production environment: a review on persistence, pathogenicity, regulation and detection methods. Microorganisms. 2023;11:1379.

3.

Boué G, Cummins E, Guillou S, Antignac JP, Le Bizec B, Membré JM. Development and application of a probabilistic risk–benefit assessment model for infant feeding integrating microbiological, nutritional, and chemical components. Risk Anal. 2017; 37:2360-2388.

4.

Cossey V, Jeurissen A, Thelissen MJ, Vanhole C, Schuermans A. Expressed breast milk on a neonatal unit: a hazard analysis and critical control points approach. Am J Infect Control. 2011;39:832-838.

5.

Jason J. The roles of epidemiologists, laboratorians, and public health agencies in preventing invasive Cronobacter infection. Front Pediatr. 2015;3:110.

6.

Yan QQ, Condell O, Power K, Butler F, Tall BD, Fanning S. Cronobacter species (formerly known as Enterobacter sakazakii) in powdered infant formula: a review of our current understanding of the biology of this bacterium. J Appl Microbiol. 2012;113:1-15.

7.

Iversen C, Mullane N, McCardell B, Tall BD, Lehner A, Fanning S, et al. Cronobacter gen. nov., a new genus to accommodate the biogroups of Enterobacter sakazakii, and proposal of Cronobacter sakazakii gen. nov., comb. nov., Cronobacter malonaticus sp. nov., Cronobacter turicensis sp. nov., Cronobacter muytjensii sp. nov., Cronobacter dublinensis sp. nov., Cronobacter genomospecies 1, and of three subspecies, Cronobacter dublinensis subsp. dublinensis subsp. nov., Cronobacter dublinensis subsp. Lausannensis subsp. nov. And Cronobacter dublinensis subsp. lactaridi subsp. nov. Int J Syst Evol Microbiol. 2008;58:1442-1447.

8.

Fei P, Jiang Y, Jiang Y, Yuan X, Yang T, Chen J, et al. Prevalence, molecular characterization, and antibiotic susceptibility of Cronobacter sakazakii isolates from powdered infant formula collected from Chinese retail markets. Front Microbiol. 2017;8:2026.

9.

Norberg S, Stanton C, Ross RP, Hill C, Fitzgerald GF, Cotter PD. Cronobacter spp. in powdered infant formula. J Food Prot. 2012;75:607-620.

10.

Henry M, Fouladkhah A. Outbreak history, biofilm formation, and preventive measures for control of Cronobacter sakazakii in infant formula and infant care settings. Microorganisms. 2019;7:77.

11.

Friedemann M. Epidemiology of invasive neonatal Cronobacter (Enterobacter sakazakii) infections. Eur J Clin Microbiol Infect Dis. 2009;28:1297-1304.

12.

Jason J. Prevention of invasive Cronobacter infections in young infants fed powdered infant formulas. Pediatrics. 2012;130:e1076-e1084.

13.

Bowen AB, Braden CR. Invasive Enterobacter sakazakii disease in infants. Emerg Infect Dis. 2006;12:1185-1189.

14.

Song KY, Seo KH, Chon JW. Rates of recovery of Enterobacter sakazakii (Cronobacter spp.) from powdered infant formula using both a chromogenic agar and real-time PCR: a preliminary study. J Dairy Sci Biotechnol. 2021;39:113-120.

15.

Chen Y, Song KY, Brown EW, Lampel KA. Development of an improved protocol for the isolation and detection of Enterobacter sakazakii (Cronobacter) from powdered infant formula. J Food Prot. 2010;73:1016-1022.

16.

Zhao T, Doyle MP. Evaluation of universal preenrichment broth for growth of heat-injured pathogens. J Food Prot. 2001;64:1751-1755.

17.

Seo KH, Brackett RE. Rapid, specific detection of Enterobacter sakazakii in infant formula using a real-time PCR assay. J Food Prot. 2005;68:59-63.

18.

Chen Y, Lampel K, Hammack T. BAM chapter 29: Cronobacter [Internet]. 2018 [cited 2023 Aug 10]. Available from: https://www.fda.gov/food/laboratory-methods/bam-chapter-29-cronobacter

19.

Scythes KD, Louie M, Simor AE. Evaluation of nutritive capacities of 10 broth media. J Clin Microbiol. 1996;34:1804-1807.

20.

Weber C, Stephan R, Druggan P, Joosten H, Iversen C. Improving the enrichment procedure for Enterobacteriacease detection. Food Microbiol. 2009;26:565-572.

21.

Hoorfar J, Baggesen DL. Importance of pre-enrichment media for isolation of Salmonella spp. from swine and poultry. FEMS Microbiol Lett. 1998;169:125-130.

22.

Park MK. Determination of best enrichment media for growth of Salmonella injured from cold temperature during process and storage. Korean J Food Preserv. 2016;23:759-764.

23.

Jiang J, Larkin C, Steele M, Poppe C, Odumeru JA. Evaluation of universal preenrichment broth for the recovery of foodborne pathogens from milk and cheese. J Dairy Sci. 1998;81:2798-2803.

24.

Choi D, Chon JW, Kim DH, Kim HS, Yim JH, Song KY, et al. Improvement of Enterobacteriaceae enrichment broth by supplementation with sodium citrate for detection of Cronobacter sakazakii using real-time PCR. Food Sci Biotechnol. 2016;25:1205-1209.

25.

Iversen C, Forsythe SJ. Comparison of media for the isolation of Enterobacter sakazakii. Appl Envrion Microbiol. 2007;73:48-52.

PDF Download
PubReader
Export Citation
Email the Author

Metrics

View
3,411
Download
964
Crossref
0
Scopus
0

QR Code of this Article: